ID: 980617905

View in Genome Browser
Species Human (GRCh38)
Location 4:135256578-135256600
Sequence CTGCTATTCCAGAGGACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980617905_980617907 9 Left 980617905 4:135256578-135256600 CCTTGTGTCCTCTGGAATAGCAG No data
Right 980617907 4:135256610-135256632 TAACTCTTGTTTGTTCTCAGTGG No data
980617905_980617908 16 Left 980617905 4:135256578-135256600 CCTTGTGTCCTCTGGAATAGCAG No data
Right 980617908 4:135256617-135256639 TGTTTGTTCTCAGTGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980617905 Original CRISPR CTGCTATTCCAGAGGACACA AGG (reversed) Intergenic
No off target data available for this crispr