ID: 980621783

View in Genome Browser
Species Human (GRCh38)
Location 4:135316694-135316716
Sequence GCAAAGTGATGGAGTTTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980621783_980621790 30 Left 980621783 4:135316694-135316716 CCATTTAAACTCCATCACTTTGC No data
Right 980621790 4:135316747-135316769 CCAACTCCTAAGATCTTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980621783 Original CRISPR GCAAAGTGATGGAGTTTAAA TGG (reversed) Intergenic
No off target data available for this crispr