ID: 980623668

View in Genome Browser
Species Human (GRCh38)
Location 4:135344332-135344354
Sequence CTACCTACACCCCTTGGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980623664_980623668 19 Left 980623664 4:135344290-135344312 CCCAGTGGTGAGGCTGGGTTTTT No data
Right 980623668 4:135344332-135344354 CTACCTACACCCCTTGGAATAGG No data
980623665_980623668 18 Left 980623665 4:135344291-135344313 CCAGTGGTGAGGCTGGGTTTTTA No data
Right 980623668 4:135344332-135344354 CTACCTACACCCCTTGGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980623668 Original CRISPR CTACCTACACCCCTTGGAAT AGG Intergenic
No off target data available for this crispr