ID: 980629520

View in Genome Browser
Species Human (GRCh38)
Location 4:135414256-135414278
Sequence AGTTATATGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980629520_980629523 15 Left 980629520 4:135414256-135414278 CCTGCCATCTTCTGCATATAACT No data
Right 980629523 4:135414294-135414316 GACAGCTCTTGGCCTGTTACTGG 0: 162
1: 189
2: 129
3: 114
4: 178
980629520_980629524 16 Left 980629520 4:135414256-135414278 CCTGCCATCTTCTGCATATAACT No data
Right 980629524 4:135414295-135414317 ACAGCTCTTGGCCTGTTACTGGG 0: 174
1: 194
2: 145
3: 123
4: 215
980629520_980629525 25 Left 980629520 4:135414256-135414278 CCTGCCATCTTCTGCATATAACT No data
Right 980629525 4:135414304-135414326 GGCCTGTTACTGGGCTTTGATGG No data
980629520_980629522 4 Left 980629520 4:135414256-135414278 CCTGCCATCTTCTGCATATAACT No data
Right 980629522 4:135414283-135414305 TTCTTTTGAGAGACAGCTCTTGG 0: 15
1: 201
2: 219
3: 189
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980629520 Original CRISPR AGTTATATGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr