ID: 980629925

View in Genome Browser
Species Human (GRCh38)
Location 4:135417979-135418001
Sequence TGGCATTACAGTATTGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980629922_980629925 9 Left 980629922 4:135417947-135417969 CCTGTGCTTGCATGAGTTAAATG No data
Right 980629925 4:135417979-135418001 TGGCATTACAGTATTGCCCAGGG No data
980629921_980629925 10 Left 980629921 4:135417946-135417968 CCCTGTGCTTGCATGAGTTAAAT No data
Right 980629925 4:135417979-135418001 TGGCATTACAGTATTGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980629925 Original CRISPR TGGCATTACAGTATTGCCCA GGG Intergenic
No off target data available for this crispr