ID: 980631073

View in Genome Browser
Species Human (GRCh38)
Location 4:135434339-135434361
Sequence TTTAGCAGCTTTGAAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980631070_980631073 -6 Left 980631070 4:135434322-135434344 CCAACAAACCCACGAAATTTAGC No data
Right 980631073 4:135434339-135434361 TTTAGCAGCTTTGAAAAAAAAGG No data
980631069_980631073 -1 Left 980631069 4:135434317-135434339 CCATTCCAACAAACCCACGAAAT No data
Right 980631073 4:135434339-135434361 TTTAGCAGCTTTGAAAAAAAAGG No data
980631066_980631073 28 Left 980631066 4:135434288-135434310 CCATTTCAGACTGAGAATGATGC No data
Right 980631073 4:135434339-135434361 TTTAGCAGCTTTGAAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980631073 Original CRISPR TTTAGCAGCTTTGAAAAAAA AGG Intergenic
No off target data available for this crispr