ID: 980652260 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:135733364-135733386 |
| Sequence | CAGCGCACTCACACAGTTGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 980652259_980652260 | -3 | Left | 980652259 | 4:135733344-135733366 | CCTCTCTTGAGAGAGCTGATCAG | No data | ||
| Right | 980652260 | 4:135733364-135733386 | CAGCGCACTCACACAGTTGCTGG | No data | ||||
| 980652258_980652260 | 9 | Left | 980652258 | 4:135733332-135733354 | CCAAAAGCAGATCCTCTCTTGAG | No data | ||
| Right | 980652260 | 4:135733364-135733386 | CAGCGCACTCACACAGTTGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 980652260 | Original CRISPR | CAGCGCACTCACACAGTTGC TGG | Intergenic | ||
| No off target data available for this crispr | |||||