ID: 980652260

View in Genome Browser
Species Human (GRCh38)
Location 4:135733364-135733386
Sequence CAGCGCACTCACACAGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980652259_980652260 -3 Left 980652259 4:135733344-135733366 CCTCTCTTGAGAGAGCTGATCAG No data
Right 980652260 4:135733364-135733386 CAGCGCACTCACACAGTTGCTGG No data
980652258_980652260 9 Left 980652258 4:135733332-135733354 CCAAAAGCAGATCCTCTCTTGAG No data
Right 980652260 4:135733364-135733386 CAGCGCACTCACACAGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980652260 Original CRISPR CAGCGCACTCACACAGTTGC TGG Intergenic
No off target data available for this crispr