ID: 980655499

View in Genome Browser
Species Human (GRCh38)
Location 4:135778481-135778503
Sequence GAATGACATCAAGCATTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980655495_980655499 22 Left 980655495 4:135778436-135778458 CCCCTAAATTTGAATTCATTGTA No data
Right 980655499 4:135778481-135778503 GAATGACATCAAGCATTTAGTGG No data
980655497_980655499 20 Left 980655497 4:135778438-135778460 CCTAAATTTGAATTCATTGTAGA No data
Right 980655499 4:135778481-135778503 GAATGACATCAAGCATTTAGTGG No data
980655496_980655499 21 Left 980655496 4:135778437-135778459 CCCTAAATTTGAATTCATTGTAG No data
Right 980655499 4:135778481-135778503 GAATGACATCAAGCATTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980655499 Original CRISPR GAATGACATCAAGCATTTAG TGG Intergenic
No off target data available for this crispr