ID: 980656097

View in Genome Browser
Species Human (GRCh38)
Location 4:135788584-135788606
Sequence AGATATGTATCTTCAAGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980656096_980656097 -7 Left 980656096 4:135788568-135788590 CCTTAGTTAAAAGTTTAGATATG No data
Right 980656097 4:135788584-135788606 AGATATGTATCTTCAAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980656097 Original CRISPR AGATATGTATCTTCAAGTAA AGG Intergenic
No off target data available for this crispr