ID: 980657452

View in Genome Browser
Species Human (GRCh38)
Location 4:135808177-135808199
Sequence TTGTGGTTAAGTTGTTTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980657449_980657452 3 Left 980657449 4:135808151-135808173 CCTCTTAATAAGTAGTGTTATGT No data
Right 980657452 4:135808177-135808199 TTGTGGTTAAGTTGTTTCCAGGG No data
980657448_980657452 4 Left 980657448 4:135808150-135808172 CCCTCTTAATAAGTAGTGTTATG No data
Right 980657452 4:135808177-135808199 TTGTGGTTAAGTTGTTTCCAGGG No data
980657447_980657452 8 Left 980657447 4:135808146-135808168 CCAACCCTCTTAATAAGTAGTGT No data
Right 980657452 4:135808177-135808199 TTGTGGTTAAGTTGTTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980657452 Original CRISPR TTGTGGTTAAGTTGTTTCCA GGG Intergenic
No off target data available for this crispr