ID: 980677717

View in Genome Browser
Species Human (GRCh38)
Location 4:136110706-136110728
Sequence GTATCACTTGAGGCGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980677717_980677722 6 Left 980677717 4:136110706-136110728 CCTGGCCTCGCCTCAAGTGATAC No data
Right 980677722 4:136110735-136110757 TTCAGCCTCCTAAAGTGCTGGGG No data
980677717_980677724 13 Left 980677717 4:136110706-136110728 CCTGGCCTCGCCTCAAGTGATAC No data
Right 980677724 4:136110742-136110764 TCCTAAAGTGCTGGGGTTACAGG 0: 126
1: 11745
2: 305885
3: 263617
4: 150706
980677717_980677721 5 Left 980677717 4:136110706-136110728 CCTGGCCTCGCCTCAAGTGATAC No data
Right 980677721 4:136110734-136110756 CTTCAGCCTCCTAAAGTGCTGGG 0: 169
1: 7907
2: 109652
3: 231490
4: 263481
980677717_980677720 4 Left 980677717 4:136110706-136110728 CCTGGCCTCGCCTCAAGTGATAC No data
Right 980677720 4:136110733-136110755 ACTTCAGCCTCCTAAAGTGCTGG 0: 55
1: 2929
2: 40959
3: 145429
4: 241105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980677717 Original CRISPR GTATCACTTGAGGCGAGGCC AGG (reversed) Intergenic
No off target data available for this crispr