ID: 980690320

View in Genome Browser
Species Human (GRCh38)
Location 4:136288546-136288568
Sequence CCTTCCAGGAATAAACTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980690320_980690326 -5 Left 980690320 4:136288546-136288568 CCCCCGAGTTTATTCCTGGAAGG No data
Right 980690326 4:136288564-136288586 GAAGGTGAACATTTCAACCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980690320 Original CRISPR CCTTCCAGGAATAAACTCGG GGG (reversed) Intergenic
No off target data available for this crispr