ID: 980691457

View in Genome Browser
Species Human (GRCh38)
Location 4:136300194-136300216
Sequence CATTCTGAGCATAGGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980691451_980691457 19 Left 980691451 4:136300152-136300174 CCCTGTGCTCTCTGTTCTCTGCC No data
Right 980691457 4:136300194-136300216 CATTCTGAGCATAGGGAGCCTGG No data
980691454_980691457 -3 Left 980691454 4:136300174-136300196 CCACACAGCAGCTGTAATCACAT No data
Right 980691457 4:136300194-136300216 CATTCTGAGCATAGGGAGCCTGG No data
980691450_980691457 20 Left 980691450 4:136300151-136300173 CCCCTGTGCTCTCTGTTCTCTGC No data
Right 980691457 4:136300194-136300216 CATTCTGAGCATAGGGAGCCTGG No data
980691453_980691457 -2 Left 980691453 4:136300173-136300195 CCCACACAGCAGCTGTAATCACA No data
Right 980691457 4:136300194-136300216 CATTCTGAGCATAGGGAGCCTGG No data
980691452_980691457 18 Left 980691452 4:136300153-136300175 CCTGTGCTCTCTGTTCTCTGCCC No data
Right 980691457 4:136300194-136300216 CATTCTGAGCATAGGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980691457 Original CRISPR CATTCTGAGCATAGGGAGCC TGG Intergenic
No off target data available for this crispr