ID: 980693527

View in Genome Browser
Species Human (GRCh38)
Location 4:136327822-136327844
Sequence CAGCTGGTCCAACCAATCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980693527_980693531 0 Left 980693527 4:136327822-136327844 CCGCAGATTGGTTGGACCAGCTG No data
Right 980693531 4:136327845-136327867 TGAGGTTTACATAGCACCCAGGG No data
980693527_980693530 -1 Left 980693527 4:136327822-136327844 CCGCAGATTGGTTGGACCAGCTG No data
Right 980693530 4:136327844-136327866 GTGAGGTTTACATAGCACCCAGG No data
980693527_980693533 8 Left 980693527 4:136327822-136327844 CCGCAGATTGGTTGGACCAGCTG No data
Right 980693533 4:136327853-136327875 ACATAGCACCCAGGGAAGGCTGG No data
980693527_980693532 4 Left 980693527 4:136327822-136327844 CCGCAGATTGGTTGGACCAGCTG No data
Right 980693532 4:136327849-136327871 GTTTACATAGCACCCAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980693527 Original CRISPR CAGCTGGTCCAACCAATCTG CGG (reversed) Intergenic
No off target data available for this crispr