ID: 980693530

View in Genome Browser
Species Human (GRCh38)
Location 4:136327844-136327866
Sequence GTGAGGTTTACATAGCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980693527_980693530 -1 Left 980693527 4:136327822-136327844 CCGCAGATTGGTTGGACCAGCTG No data
Right 980693530 4:136327844-136327866 GTGAGGTTTACATAGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980693530 Original CRISPR GTGAGGTTTACATAGCACCC AGG Intergenic
No off target data available for this crispr