ID: 980694526

View in Genome Browser
Species Human (GRCh38)
Location 4:136337744-136337766
Sequence CCAAGCTGGGGGTCCCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980694526_980694534 5 Left 980694526 4:136337744-136337766 CCAGGCAGGGACCCCCAGCTTGG No data
Right 980694534 4:136337772-136337794 CAACACAGCCACCCAACCCTGGG No data
980694526_980694540 22 Left 980694526 4:136337744-136337766 CCAGGCAGGGACCCCCAGCTTGG No data
Right 980694540 4:136337789-136337811 CCTGGGCCAACTGTACCAATTGG No data
980694526_980694533 4 Left 980694526 4:136337744-136337766 CCAGGCAGGGACCCCCAGCTTGG No data
Right 980694533 4:136337771-136337793 ACAACACAGCCACCCAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980694526 Original CRISPR CCAAGCTGGGGGTCCCTGCC TGG (reversed) Intergenic
No off target data available for this crispr