ID: 980694530

View in Genome Browser
Species Human (GRCh38)
Location 4:136337757-136337779
Sequence CTGTGTTGTGGAACCAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980694530_980694534 -8 Left 980694530 4:136337757-136337779 CCCAGCTTGGTTCCACAACACAG No data
Right 980694534 4:136337772-136337794 CAACACAGCCACCCAACCCTGGG No data
980694530_980694533 -9 Left 980694530 4:136337757-136337779 CCCAGCTTGGTTCCACAACACAG No data
Right 980694533 4:136337771-136337793 ACAACACAGCCACCCAACCCTGG No data
980694530_980694540 9 Left 980694530 4:136337757-136337779 CCCAGCTTGGTTCCACAACACAG No data
Right 980694540 4:136337789-136337811 CCTGGGCCAACTGTACCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980694530 Original CRISPR CTGTGTTGTGGAACCAAGCT GGG (reversed) Intergenic
No off target data available for this crispr