ID: 980694532

View in Genome Browser
Species Human (GRCh38)
Location 4:136337769-136337791
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980694532_980694540 -3 Left 980694532 4:136337769-136337791 CCACAACACAGCCACCCAACCCT No data
Right 980694540 4:136337789-136337811 CCTGGGCCAACTGTACCAATTGG No data
980694532_980694546 24 Left 980694532 4:136337769-136337791 CCACAACACAGCCACCCAACCCT No data
Right 980694546 4:136337816-136337838 AGATCCACATTTCTCTGGGGTGG No data
980694532_980694545 21 Left 980694532 4:136337769-136337791 CCACAACACAGCCACCCAACCCT No data
Right 980694545 4:136337813-136337835 AGCAGATCCACATTTCTCTGGGG No data
980694532_980694543 19 Left 980694532 4:136337769-136337791 CCACAACACAGCCACCCAACCCT No data
Right 980694543 4:136337811-136337833 GTAGCAGATCCACATTTCTCTGG No data
980694532_980694544 20 Left 980694532 4:136337769-136337791 CCACAACACAGCCACCCAACCCT No data
Right 980694544 4:136337812-136337834 TAGCAGATCCACATTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980694532 Original CRISPR AGGGTTGGGTGGCTGTGTTG TGG (reversed) Intergenic
No off target data available for this crispr