ID: 980694533

View in Genome Browser
Species Human (GRCh38)
Location 4:136337771-136337793
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980694530_980694533 -9 Left 980694530 4:136337757-136337779 CCCAGCTTGGTTCCACAACACAG No data
Right 980694533 4:136337771-136337793 ACAACACAGCCACCCAACCCTGG No data
980694519_980694533 25 Left 980694519 4:136337723-136337745 CCTTGTCCCCACTGTTTGTCACC No data
Right 980694533 4:136337771-136337793 ACAACACAGCCACCCAACCCTGG No data
980694524_980694533 17 Left 980694524 4:136337731-136337753 CCACTGTTTGTCACCAGGCAGGG No data
Right 980694533 4:136337771-136337793 ACAACACAGCCACCCAACCCTGG No data
980694521_980694533 19 Left 980694521 4:136337729-136337751 CCCCACTGTTTGTCACCAGGCAG No data
Right 980694533 4:136337771-136337793 ACAACACAGCCACCCAACCCTGG No data
980694526_980694533 4 Left 980694526 4:136337744-136337766 CCAGGCAGGGACCCCCAGCTTGG No data
Right 980694533 4:136337771-136337793 ACAACACAGCCACCCAACCCTGG No data
980694528_980694533 -7 Left 980694528 4:136337755-136337777 CCCCCAGCTTGGTTCCACAACAC No data
Right 980694533 4:136337771-136337793 ACAACACAGCCACCCAACCCTGG No data
980694517_980694533 27 Left 980694517 4:136337721-136337743 CCCCTTGTCCCCACTGTTTGTCA No data
Right 980694533 4:136337771-136337793 ACAACACAGCCACCCAACCCTGG No data
980694522_980694533 18 Left 980694522 4:136337730-136337752 CCCACTGTTTGTCACCAGGCAGG No data
Right 980694533 4:136337771-136337793 ACAACACAGCCACCCAACCCTGG No data
980694518_980694533 26 Left 980694518 4:136337722-136337744 CCCTTGTCCCCACTGTTTGTCAC No data
Right 980694533 4:136337771-136337793 ACAACACAGCCACCCAACCCTGG No data
980694531_980694533 -10 Left 980694531 4:136337758-136337780 CCAGCTTGGTTCCACAACACAGC No data
Right 980694533 4:136337771-136337793 ACAACACAGCCACCCAACCCTGG No data
980694529_980694533 -8 Left 980694529 4:136337756-136337778 CCCCAGCTTGGTTCCACAACACA No data
Right 980694533 4:136337771-136337793 ACAACACAGCCACCCAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type