ID: 980694540

View in Genome Browser
Species Human (GRCh38)
Location 4:136337789-136337811
Sequence CCTGGGCCAACTGTACCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980694530_980694540 9 Left 980694530 4:136337757-136337779 CCCAGCTTGGTTCCACAACACAG No data
Right 980694540 4:136337789-136337811 CCTGGGCCAACTGTACCAATTGG No data
980694528_980694540 11 Left 980694528 4:136337755-136337777 CCCCCAGCTTGGTTCCACAACAC No data
Right 980694540 4:136337789-136337811 CCTGGGCCAACTGTACCAATTGG No data
980694526_980694540 22 Left 980694526 4:136337744-136337766 CCAGGCAGGGACCCCCAGCTTGG No data
Right 980694540 4:136337789-136337811 CCTGGGCCAACTGTACCAATTGG No data
980694529_980694540 10 Left 980694529 4:136337756-136337778 CCCCAGCTTGGTTCCACAACACA No data
Right 980694540 4:136337789-136337811 CCTGGGCCAACTGTACCAATTGG No data
980694531_980694540 8 Left 980694531 4:136337758-136337780 CCAGCTTGGTTCCACAACACAGC No data
Right 980694540 4:136337789-136337811 CCTGGGCCAACTGTACCAATTGG No data
980694532_980694540 -3 Left 980694532 4:136337769-136337791 CCACAACACAGCCACCCAACCCT No data
Right 980694540 4:136337789-136337811 CCTGGGCCAACTGTACCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980694540 Original CRISPR CCTGGGCCAACTGTACCAAT TGG Intergenic
No off target data available for this crispr