ID: 980694545

View in Genome Browser
Species Human (GRCh38)
Location 4:136337813-136337835
Sequence AGCAGATCCACATTTCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980694536_980694545 7 Left 980694536 4:136337783-136337805 CCCAACCCTGGGCCAACTGTACC No data
Right 980694545 4:136337813-136337835 AGCAGATCCACATTTCTCTGGGG No data
980694541_980694545 -5 Left 980694541 4:136337795-136337817 CCAACTGTACCAATTGGTAGCAG No data
Right 980694545 4:136337813-136337835 AGCAGATCCACATTTCTCTGGGG No data
980694538_980694545 2 Left 980694538 4:136337788-136337810 CCCTGGGCCAACTGTACCAATTG No data
Right 980694545 4:136337813-136337835 AGCAGATCCACATTTCTCTGGGG No data
980694539_980694545 1 Left 980694539 4:136337789-136337811 CCTGGGCCAACTGTACCAATTGG No data
Right 980694545 4:136337813-136337835 AGCAGATCCACATTTCTCTGGGG No data
980694532_980694545 21 Left 980694532 4:136337769-136337791 CCACAACACAGCCACCCAACCCT No data
Right 980694545 4:136337813-136337835 AGCAGATCCACATTTCTCTGGGG No data
980694535_980694545 10 Left 980694535 4:136337780-136337802 CCACCCAACCCTGGGCCAACTGT No data
Right 980694545 4:136337813-136337835 AGCAGATCCACATTTCTCTGGGG No data
980694537_980694545 6 Left 980694537 4:136337784-136337806 CCAACCCTGGGCCAACTGTACCA No data
Right 980694545 4:136337813-136337835 AGCAGATCCACATTTCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980694545 Original CRISPR AGCAGATCCACATTTCTCTG GGG Intergenic
No off target data available for this crispr