ID: 980712638

View in Genome Browser
Species Human (GRCh38)
Location 4:136590671-136590693
Sequence AAGAAGAGCACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980712626_980712638 27 Left 980712626 4:136590621-136590643 CCCCTGGAGGCCACTGCATGCCA No data
Right 980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG No data
980712632_980712638 17 Left 980712632 4:136590631-136590653 CCACTGCATGCCATGGTGGGAGA No data
Right 980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG No data
980712627_980712638 26 Left 980712627 4:136590622-136590644 CCCTGGAGGCCACTGCATGCCAT No data
Right 980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG No data
980712633_980712638 7 Left 980712633 4:136590641-136590663 CCATGGTGGGAGAATCTGTGCAT No data
Right 980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG No data
980712628_980712638 25 Left 980712628 4:136590623-136590645 CCTGGAGGCCACTGCATGCCATG No data
Right 980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980712638 Original CRISPR AAGAAGAGCACAGTGATTGT GGG Intergenic
No off target data available for this crispr