ID: 980716691

View in Genome Browser
Species Human (GRCh38)
Location 4:136637804-136637826
Sequence TTAGTAGGCAGGAATTAGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980716691_980716707 30 Left 980716691 4:136637804-136637826 CCGTACTAATTCCTGCCTACTAA No data
Right 980716707 4:136637857-136637879 TCATGGCATAAACAGGCTCAGGG No data
980716691_980716706 29 Left 980716691 4:136637804-136637826 CCGTACTAATTCCTGCCTACTAA No data
Right 980716706 4:136637856-136637878 TTCATGGCATAAACAGGCTCAGG No data
980716691_980716705 23 Left 980716691 4:136637804-136637826 CCGTACTAATTCCTGCCTACTAA No data
Right 980716705 4:136637850-136637872 CTATGCTTCATGGCATAAACAGG No data
980716691_980716694 -3 Left 980716691 4:136637804-136637826 CCGTACTAATTCCTGCCTACTAA No data
Right 980716694 4:136637824-136637846 TAAACCCCCCACCCCACAGAAGG No data
980716691_980716695 0 Left 980716691 4:136637804-136637826 CCGTACTAATTCCTGCCTACTAA No data
Right 980716695 4:136637827-136637849 ACCCCCCACCCCACAGAAGGAGG No data
980716691_980716704 13 Left 980716691 4:136637804-136637826 CCGTACTAATTCCTGCCTACTAA No data
Right 980716704 4:136637840-136637862 CAGAAGGAGGCTATGCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980716691 Original CRISPR TTAGTAGGCAGGAATTAGTA CGG (reversed) Intergenic
No off target data available for this crispr