ID: 980716692

View in Genome Browser
Species Human (GRCh38)
Location 4:136637815-136637837
Sequence GGGTGGGGGGTTTAGTAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980716692_980716705 12 Left 980716692 4:136637815-136637837 CCTGCCTACTAAACCCCCCACCC No data
Right 980716705 4:136637850-136637872 CTATGCTTCATGGCATAAACAGG No data
980716692_980716706 18 Left 980716692 4:136637815-136637837 CCTGCCTACTAAACCCCCCACCC No data
Right 980716706 4:136637856-136637878 TTCATGGCATAAACAGGCTCAGG No data
980716692_980716707 19 Left 980716692 4:136637815-136637837 CCTGCCTACTAAACCCCCCACCC No data
Right 980716707 4:136637857-136637879 TCATGGCATAAACAGGCTCAGGG No data
980716692_980716704 2 Left 980716692 4:136637815-136637837 CCTGCCTACTAAACCCCCCACCC No data
Right 980716704 4:136637840-136637862 CAGAAGGAGGCTATGCTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980716692 Original CRISPR GGGTGGGGGGTTTAGTAGGC AGG (reversed) Intergenic
No off target data available for this crispr