ID: 980716693

View in Genome Browser
Species Human (GRCh38)
Location 4:136637819-136637841
Sequence TGTGGGGTGGGGGGTTTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980716693_980716706 14 Left 980716693 4:136637819-136637841 CCTACTAAACCCCCCACCCCACA No data
Right 980716706 4:136637856-136637878 TTCATGGCATAAACAGGCTCAGG No data
980716693_980716704 -2 Left 980716693 4:136637819-136637841 CCTACTAAACCCCCCACCCCACA No data
Right 980716704 4:136637840-136637862 CAGAAGGAGGCTATGCTTCATGG No data
980716693_980716707 15 Left 980716693 4:136637819-136637841 CCTACTAAACCCCCCACCCCACA No data
Right 980716707 4:136637857-136637879 TCATGGCATAAACAGGCTCAGGG No data
980716693_980716705 8 Left 980716693 4:136637819-136637841 CCTACTAAACCCCCCACCCCACA No data
Right 980716705 4:136637850-136637872 CTATGCTTCATGGCATAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980716693 Original CRISPR TGTGGGGTGGGGGGTTTAGT AGG (reversed) Intergenic
No off target data available for this crispr