ID: 980716696

View in Genome Browser
Species Human (GRCh38)
Location 4:136637828-136637850
Sequence GCCTCCTTCTGTGGGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980716696_980716708 30 Left 980716696 4:136637828-136637850 CCCCCCACCCCACAGAAGGAGGC No data
Right 980716708 4:136637881-136637903 TCCCAAAGTTTGCTGACAGCAGG No data
980716696_980716707 6 Left 980716696 4:136637828-136637850 CCCCCCACCCCACAGAAGGAGGC No data
Right 980716707 4:136637857-136637879 TCATGGCATAAACAGGCTCAGGG No data
980716696_980716706 5 Left 980716696 4:136637828-136637850 CCCCCCACCCCACAGAAGGAGGC No data
Right 980716706 4:136637856-136637878 TTCATGGCATAAACAGGCTCAGG No data
980716696_980716705 -1 Left 980716696 4:136637828-136637850 CCCCCCACCCCACAGAAGGAGGC No data
Right 980716705 4:136637850-136637872 CTATGCTTCATGGCATAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980716696 Original CRISPR GCCTCCTTCTGTGGGGTGGG GGG (reversed) Intergenic
No off target data available for this crispr