ID: 980716700

View in Genome Browser
Species Human (GRCh38)
Location 4:136637832-136637854
Sequence CATAGCCTCCTTCTGTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980716700_980716707 2 Left 980716700 4:136637832-136637854 CCACCCCACAGAAGGAGGCTATG No data
Right 980716707 4:136637857-136637879 TCATGGCATAAACAGGCTCAGGG No data
980716700_980716710 27 Left 980716700 4:136637832-136637854 CCACCCCACAGAAGGAGGCTATG No data
Right 980716710 4:136637882-136637904 CCCAAAGTTTGCTGACAGCAGGG No data
980716700_980716708 26 Left 980716700 4:136637832-136637854 CCACCCCACAGAAGGAGGCTATG No data
Right 980716708 4:136637881-136637903 TCCCAAAGTTTGCTGACAGCAGG No data
980716700_980716706 1 Left 980716700 4:136637832-136637854 CCACCCCACAGAAGGAGGCTATG No data
Right 980716706 4:136637856-136637878 TTCATGGCATAAACAGGCTCAGG No data
980716700_980716705 -5 Left 980716700 4:136637832-136637854 CCACCCCACAGAAGGAGGCTATG No data
Right 980716705 4:136637850-136637872 CTATGCTTCATGGCATAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980716700 Original CRISPR CATAGCCTCCTTCTGTGGGG TGG (reversed) Intergenic
No off target data available for this crispr