ID: 980716701

View in Genome Browser
Species Human (GRCh38)
Location 4:136637835-136637857
Sequence AAGCATAGCCTCCTTCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980716701_980716707 -1 Left 980716701 4:136637835-136637857 CCCCACAGAAGGAGGCTATGCTT No data
Right 980716707 4:136637857-136637879 TCATGGCATAAACAGGCTCAGGG No data
980716701_980716706 -2 Left 980716701 4:136637835-136637857 CCCCACAGAAGGAGGCTATGCTT No data
Right 980716706 4:136637856-136637878 TTCATGGCATAAACAGGCTCAGG No data
980716701_980716710 24 Left 980716701 4:136637835-136637857 CCCCACAGAAGGAGGCTATGCTT No data
Right 980716710 4:136637882-136637904 CCCAAAGTTTGCTGACAGCAGGG No data
980716701_980716705 -8 Left 980716701 4:136637835-136637857 CCCCACAGAAGGAGGCTATGCTT No data
Right 980716705 4:136637850-136637872 CTATGCTTCATGGCATAAACAGG No data
980716701_980716708 23 Left 980716701 4:136637835-136637857 CCCCACAGAAGGAGGCTATGCTT No data
Right 980716708 4:136637881-136637903 TCCCAAAGTTTGCTGACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980716701 Original CRISPR AAGCATAGCCTCCTTCTGTG GGG (reversed) Intergenic
No off target data available for this crispr