ID: 980716703

View in Genome Browser
Species Human (GRCh38)
Location 4:136637837-136637859
Sequence TGAAGCATAGCCTCCTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980716703_980716710 22 Left 980716703 4:136637837-136637859 CCACAGAAGGAGGCTATGCTTCA No data
Right 980716710 4:136637882-136637904 CCCAAAGTTTGCTGACAGCAGGG No data
980716703_980716708 21 Left 980716703 4:136637837-136637859 CCACAGAAGGAGGCTATGCTTCA No data
Right 980716708 4:136637881-136637903 TCCCAAAGTTTGCTGACAGCAGG No data
980716703_980716712 30 Left 980716703 4:136637837-136637859 CCACAGAAGGAGGCTATGCTTCA No data
Right 980716712 4:136637890-136637912 TTGCTGACAGCAGGGAGAAATGG No data
980716703_980716705 -10 Left 980716703 4:136637837-136637859 CCACAGAAGGAGGCTATGCTTCA No data
Right 980716705 4:136637850-136637872 CTATGCTTCATGGCATAAACAGG No data
980716703_980716707 -3 Left 980716703 4:136637837-136637859 CCACAGAAGGAGGCTATGCTTCA No data
Right 980716707 4:136637857-136637879 TCATGGCATAAACAGGCTCAGGG No data
980716703_980716706 -4 Left 980716703 4:136637837-136637859 CCACAGAAGGAGGCTATGCTTCA No data
Right 980716706 4:136637856-136637878 TTCATGGCATAAACAGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980716703 Original CRISPR TGAAGCATAGCCTCCTTCTG TGG (reversed) Intergenic
No off target data available for this crispr