ID: 980716705

View in Genome Browser
Species Human (GRCh38)
Location 4:136637850-136637872
Sequence CTATGCTTCATGGCATAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980716702_980716705 -9 Left 980716702 4:136637836-136637858 CCCACAGAAGGAGGCTATGCTTC No data
Right 980716705 4:136637850-136637872 CTATGCTTCATGGCATAAACAGG No data
980716701_980716705 -8 Left 980716701 4:136637835-136637857 CCCCACAGAAGGAGGCTATGCTT No data
Right 980716705 4:136637850-136637872 CTATGCTTCATGGCATAAACAGG No data
980716693_980716705 8 Left 980716693 4:136637819-136637841 CCTACTAAACCCCCCACCCCACA No data
Right 980716705 4:136637850-136637872 CTATGCTTCATGGCATAAACAGG No data
980716703_980716705 -10 Left 980716703 4:136637837-136637859 CCACAGAAGGAGGCTATGCTTCA No data
Right 980716705 4:136637850-136637872 CTATGCTTCATGGCATAAACAGG No data
980716697_980716705 -2 Left 980716697 4:136637829-136637851 CCCCCACCCCACAGAAGGAGGCT No data
Right 980716705 4:136637850-136637872 CTATGCTTCATGGCATAAACAGG No data
980716698_980716705 -3 Left 980716698 4:136637830-136637852 CCCCACCCCACAGAAGGAGGCTA No data
Right 980716705 4:136637850-136637872 CTATGCTTCATGGCATAAACAGG No data
980716696_980716705 -1 Left 980716696 4:136637828-136637850 CCCCCCACCCCACAGAAGGAGGC No data
Right 980716705 4:136637850-136637872 CTATGCTTCATGGCATAAACAGG No data
980716700_980716705 -5 Left 980716700 4:136637832-136637854 CCACCCCACAGAAGGAGGCTATG No data
Right 980716705 4:136637850-136637872 CTATGCTTCATGGCATAAACAGG No data
980716699_980716705 -4 Left 980716699 4:136637831-136637853 CCCACCCCACAGAAGGAGGCTAT No data
Right 980716705 4:136637850-136637872 CTATGCTTCATGGCATAAACAGG No data
980716691_980716705 23 Left 980716691 4:136637804-136637826 CCGTACTAATTCCTGCCTACTAA No data
Right 980716705 4:136637850-136637872 CTATGCTTCATGGCATAAACAGG No data
980716692_980716705 12 Left 980716692 4:136637815-136637837 CCTGCCTACTAAACCCCCCACCC No data
Right 980716705 4:136637850-136637872 CTATGCTTCATGGCATAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980716705 Original CRISPR CTATGCTTCATGGCATAAAC AGG Intergenic
No off target data available for this crispr