ID: 980723046

View in Genome Browser
Species Human (GRCh38)
Location 4:136721485-136721507
Sequence GACTGAATTTTTGTTCCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980723039_980723046 28 Left 980723039 4:136721434-136721456 CCTTTTCACCCAATAAAACCCTG 0: 92
1: 110
2: 67
3: 57
4: 309
Right 980723046 4:136721485-136721507 GACTGAATTTTTGTTCCCACGGG No data
980723042_980723046 10 Left 980723042 4:136721452-136721474 CCCTGTCTTACTCACCATTCGAA No data
Right 980723046 4:136721485-136721507 GACTGAATTTTTGTTCCCACGGG No data
980723040_980723046 20 Left 980723040 4:136721442-136721464 CCCAATAAAACCCTGTCTTACTC 0: 38
1: 46
2: 99
3: 85
4: 218
Right 980723046 4:136721485-136721507 GACTGAATTTTTGTTCCCACGGG No data
980723043_980723046 9 Left 980723043 4:136721453-136721475 CCTGTCTTACTCACCATTCGAAT No data
Right 980723046 4:136721485-136721507 GACTGAATTTTTGTTCCCACGGG No data
980723044_980723046 -4 Left 980723044 4:136721466-136721488 CCATTCGAATTGTCTGTGAGACT No data
Right 980723046 4:136721485-136721507 GACTGAATTTTTGTTCCCACGGG No data
980723041_980723046 19 Left 980723041 4:136721443-136721465 CCAATAAAACCCTGTCTTACTCA 0: 35
1: 42
2: 95
3: 102
4: 262
Right 980723046 4:136721485-136721507 GACTGAATTTTTGTTCCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980723046 Original CRISPR GACTGAATTTTTGTTCCCAC GGG Intergenic
No off target data available for this crispr