ID: 980724027

View in Genome Browser
Species Human (GRCh38)
Location 4:136734969-136734991
Sequence AACCATATGGTGATCCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980724027_980724032 12 Left 980724027 4:136734969-136734991 CCTGTCAGGATCACCATATGGTT No data
Right 980724032 4:136735004-136735026 AACCCCAGAATGTCATCTTCAGG No data
980724027_980724036 27 Left 980724027 4:136734969-136734991 CCTGTCAGGATCACCATATGGTT No data
Right 980724036 4:136735019-136735041 TCTTCAGGTCTTTCTCATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980724027 Original CRISPR AACCATATGGTGATCCTGAC AGG (reversed) Intergenic
No off target data available for this crispr