ID: 980724099

View in Genome Browser
Species Human (GRCh38)
Location 4:136735697-136735719
Sequence ACACCTTGCTTGCCTTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980724099_980724103 5 Left 980724099 4:136735697-136735719 CCTACAAAAGGCAAGCAAGGTGT No data
Right 980724103 4:136735725-136735747 TGATGAACGTTAGCATGGGGAGG No data
980724099_980724104 6 Left 980724099 4:136735697-136735719 CCTACAAAAGGCAAGCAAGGTGT No data
Right 980724104 4:136735726-136735748 GATGAACGTTAGCATGGGGAGGG No data
980724099_980724100 0 Left 980724099 4:136735697-136735719 CCTACAAAAGGCAAGCAAGGTGT No data
Right 980724100 4:136735720-136735742 TAAGCTGATGAACGTTAGCATGG No data
980724099_980724101 1 Left 980724099 4:136735697-136735719 CCTACAAAAGGCAAGCAAGGTGT No data
Right 980724101 4:136735721-136735743 AAGCTGATGAACGTTAGCATGGG No data
980724099_980724102 2 Left 980724099 4:136735697-136735719 CCTACAAAAGGCAAGCAAGGTGT No data
Right 980724102 4:136735722-136735744 AGCTGATGAACGTTAGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980724099 Original CRISPR ACACCTTGCTTGCCTTTTGT AGG (reversed) Intergenic
No off target data available for this crispr