ID: 980724104

View in Genome Browser
Species Human (GRCh38)
Location 4:136735726-136735748
Sequence GATGAACGTTAGCATGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980724099_980724104 6 Left 980724099 4:136735697-136735719 CCTACAAAAGGCAAGCAAGGTGT No data
Right 980724104 4:136735726-136735748 GATGAACGTTAGCATGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980724104 Original CRISPR GATGAACGTTAGCATGGGGA GGG Intergenic
No off target data available for this crispr