ID: 980731968

View in Genome Browser
Species Human (GRCh38)
Location 4:136835479-136835501
Sequence ACCCACAAAGTGATGGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980731964_980731968 3 Left 980731964 4:136835453-136835475 CCCAAAATTCATATGCTGAAATC 0: 22
1: 291
2: 1151
3: 2544
4: 3990
Right 980731968 4:136835479-136835501 ACCCACAAAGTGATGGTAGTAGG No data
980731965_980731968 2 Left 980731965 4:136835454-136835476 CCAAAATTCATATGCTGAAATCC 0: 32
1: 362
2: 1195
3: 2693
4: 3889
Right 980731968 4:136835479-136835501 ACCCACAAAGTGATGGTAGTAGG No data
980731963_980731968 4 Left 980731963 4:136835452-136835474 CCCCAAAATTCATATGCTGAAAT 0: 26
1: 344
2: 1171
3: 2639
4: 4101
Right 980731968 4:136835479-136835501 ACCCACAAAGTGATGGTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980731968 Original CRISPR ACCCACAAAGTGATGGTAGT AGG Intergenic
No off target data available for this crispr