ID: 980733484

View in Genome Browser
Species Human (GRCh38)
Location 4:136851176-136851198
Sequence ATATAGTTCTGCAGCTAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980733482_980733484 0 Left 980733482 4:136851153-136851175 CCAAAGGCTTCAGCAAATCCTGC No data
Right 980733484 4:136851176-136851198 ATATAGTTCTGCAGCTAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980733484 Original CRISPR ATATAGTTCTGCAGCTAAGA TGG Intergenic
No off target data available for this crispr