ID: 980734242

View in Genome Browser
Species Human (GRCh38)
Location 4:136863911-136863933
Sequence AAATAGCCACAGAGGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980734239_980734242 -5 Left 980734239 4:136863893-136863915 CCTTGTGTGTTAGGAGTGAAATA No data
Right 980734242 4:136863911-136863933 AAATAGCCACAGAGGGAGCTTGG No data
980734237_980734242 14 Left 980734237 4:136863874-136863896 CCTCTAGGAACAGCAGCAACCTT No data
Right 980734242 4:136863911-136863933 AAATAGCCACAGAGGGAGCTTGG No data
980734236_980734242 15 Left 980734236 4:136863873-136863895 CCCTCTAGGAACAGCAGCAACCT No data
Right 980734242 4:136863911-136863933 AAATAGCCACAGAGGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980734242 Original CRISPR AAATAGCCACAGAGGGAGCT TGG Intergenic
No off target data available for this crispr