ID: 980739171

View in Genome Browser
Species Human (GRCh38)
Location 4:136928766-136928788
Sequence ACCTCTCCTTCTGTTGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980739171_980739173 -8 Left 980739171 4:136928766-136928788 CCAGGAACAACAGAAGGAGAGGT No data
Right 980739173 4:136928781-136928803 GGAGAGGTATTTACATAAGTGGG No data
980739171_980739175 17 Left 980739171 4:136928766-136928788 CCAGGAACAACAGAAGGAGAGGT No data
Right 980739175 4:136928806-136928828 TTGTTAAAACTCAACAAATTGGG No data
980739171_980739176 20 Left 980739171 4:136928766-136928788 CCAGGAACAACAGAAGGAGAGGT No data
Right 980739176 4:136928809-136928831 TTAAAACTCAACAAATTGGGAGG No data
980739171_980739174 16 Left 980739171 4:136928766-136928788 CCAGGAACAACAGAAGGAGAGGT No data
Right 980739174 4:136928805-136928827 ATTGTTAAAACTCAACAAATTGG No data
980739171_980739172 -9 Left 980739171 4:136928766-136928788 CCAGGAACAACAGAAGGAGAGGT No data
Right 980739172 4:136928780-136928802 AGGAGAGGTATTTACATAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980739171 Original CRISPR ACCTCTCCTTCTGTTGTTCC TGG (reversed) Intergenic
No off target data available for this crispr