ID: 980741834

View in Genome Browser
Species Human (GRCh38)
Location 4:136960603-136960625
Sequence CATGGTAAACAGAACGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980741834_980741841 27 Left 980741834 4:136960603-136960625 CCCTCACCGTTCTGTTTACCATG No data
Right 980741841 4:136960653-136960675 TAGCTCTGTCTAATTTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980741834 Original CRISPR CATGGTAAACAGAACGGTGA GGG (reversed) Intergenic
No off target data available for this crispr