ID: 980749318

View in Genome Browser
Species Human (GRCh38)
Location 4:137068642-137068664
Sequence TAAATGACATTGAGACCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980749318_980749323 20 Left 980749318 4:137068642-137068664 CCCCTTGGTCTCAATGTCATTTA No data
Right 980749323 4:137068685-137068707 CCTCTTGCAGTGTATTCCCCAGG No data
980749318_980749324 21 Left 980749318 4:137068642-137068664 CCCCTTGGTCTCAATGTCATTTA No data
Right 980749324 4:137068686-137068708 CTCTTGCAGTGTATTCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980749318 Original CRISPR TAAATGACATTGAGACCAAG GGG (reversed) Intergenic
No off target data available for this crispr