ID: 980750196

View in Genome Browser
Species Human (GRCh38)
Location 4:137077506-137077528
Sequence CTGGATCCACAGCTGCAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980750190_980750196 1 Left 980750190 4:137077482-137077504 CCCCCACCAAGAGCACAGGAAGA No data
Right 980750196 4:137077506-137077528 CTGGATCCACAGCTGCAGTTTGG No data
980750186_980750196 16 Left 980750186 4:137077467-137077489 CCTGCCTGCTCCTGTCCCCCACC No data
Right 980750196 4:137077506-137077528 CTGGATCCACAGCTGCAGTTTGG No data
980750195_980750196 -5 Left 980750195 4:137077488-137077510 CCAAGAGCACAGGAAGATCTGGA No data
Right 980750196 4:137077506-137077528 CTGGATCCACAGCTGCAGTTTGG No data
980750191_980750196 0 Left 980750191 4:137077483-137077505 CCCCACCAAGAGCACAGGAAGAT No data
Right 980750196 4:137077506-137077528 CTGGATCCACAGCTGCAGTTTGG No data
980750187_980750196 12 Left 980750187 4:137077471-137077493 CCTGCTCCTGTCCCCCACCAAGA No data
Right 980750196 4:137077506-137077528 CTGGATCCACAGCTGCAGTTTGG No data
980750193_980750196 -2 Left 980750193 4:137077485-137077507 CCACCAAGAGCACAGGAAGATCT No data
Right 980750196 4:137077506-137077528 CTGGATCCACAGCTGCAGTTTGG No data
980750188_980750196 6 Left 980750188 4:137077477-137077499 CCTGTCCCCCACCAAGAGCACAG No data
Right 980750196 4:137077506-137077528 CTGGATCCACAGCTGCAGTTTGG No data
980750192_980750196 -1 Left 980750192 4:137077484-137077506 CCCACCAAGAGCACAGGAAGATC No data
Right 980750196 4:137077506-137077528 CTGGATCCACAGCTGCAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980750196 Original CRISPR CTGGATCCACAGCTGCAGTT TGG Intergenic
No off target data available for this crispr