ID: 980754811

View in Genome Browser
Species Human (GRCh38)
Location 4:137144327-137144349
Sequence TACACTGAAATGTCTTAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980754811_980754812 24 Left 980754811 4:137144327-137144349 CCAGCTTAAGACATTTCAGTGTA No data
Right 980754812 4:137144374-137144396 TTGTGTAAGAGATACTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980754811 Original CRISPR TACACTGAAATGTCTTAAGC TGG (reversed) Intergenic
No off target data available for this crispr