ID: 980754812

View in Genome Browser
Species Human (GRCh38)
Location 4:137144374-137144396
Sequence TTGTGTAAGAGATACTCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980754811_980754812 24 Left 980754811 4:137144327-137144349 CCAGCTTAAGACATTTCAGTGTA No data
Right 980754812 4:137144374-137144396 TTGTGTAAGAGATACTCAAATGG No data
980754810_980754812 25 Left 980754810 4:137144326-137144348 CCCAGCTTAAGACATTTCAGTGT No data
Right 980754812 4:137144374-137144396 TTGTGTAAGAGATACTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980754812 Original CRISPR TTGTGTAAGAGATACTCAAA TGG Intergenic
No off target data available for this crispr