ID: 980759180

View in Genome Browser
Species Human (GRCh38)
Location 4:137205987-137206009
Sequence TGTGATTCCATGTGAATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980759177_980759180 26 Left 980759177 4:137205938-137205960 CCAGCTTTGTACTTTTTTCTCAA No data
Right 980759180 4:137205987-137206009 TGTGATTCCATGTGAATTTCAGG No data
980759176_980759180 29 Left 980759176 4:137205935-137205957 CCTCCAGCTTTGTACTTTTTTCT No data
Right 980759180 4:137205987-137206009 TGTGATTCCATGTGAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980759180 Original CRISPR TGTGATTCCATGTGAATTTC AGG Intergenic
No off target data available for this crispr