ID: 980763994

View in Genome Browser
Species Human (GRCh38)
Location 4:137274708-137274730
Sequence TTCAAAGATATGAAGATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980763994_980763995 -4 Left 980763994 4:137274708-137274730 CCTTTGATCTTCATATCTTTGAA No data
Right 980763995 4:137274727-137274749 TGAACCAATTTAGCGTACTATGG No data
980763994_980763997 4 Left 980763994 4:137274708-137274730 CCTTTGATCTTCATATCTTTGAA No data
Right 980763997 4:137274735-137274757 TTTAGCGTACTATGGAATCATGG No data
980763994_980763998 14 Left 980763994 4:137274708-137274730 CCTTTGATCTTCATATCTTTGAA No data
Right 980763998 4:137274745-137274767 TATGGAATCATGGATAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980763994 Original CRISPR TTCAAAGATATGAAGATCAA AGG (reversed) Intergenic
No off target data available for this crispr