ID: 980765224

View in Genome Browser
Species Human (GRCh38)
Location 4:137294105-137294127
Sequence CTCAGACACCAGTAGTTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980765222_980765224 9 Left 980765222 4:137294073-137294095 CCTAGGCAAATGGAAGATACAAA No data
Right 980765224 4:137294105-137294127 CTCAGACACCAGTAGTTACTGGG No data
980765220_980765224 24 Left 980765220 4:137294058-137294080 CCTCAGAACTGTTTGCCTAGGCA No data
Right 980765224 4:137294105-137294127 CTCAGACACCAGTAGTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980765224 Original CRISPR CTCAGACACCAGTAGTTACT GGG Intergenic
No off target data available for this crispr