ID: 980767850

View in Genome Browser
Species Human (GRCh38)
Location 4:137331503-137331525
Sequence CAGTATAAGAAGAAACAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980767850_980767853 2 Left 980767850 4:137331503-137331525 CCTGCCTGTTTCTTCTTATACTG No data
Right 980767853 4:137331528-137331550 TAACACCCCCAAGTGAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980767850 Original CRISPR CAGTATAAGAAGAAACAGGC AGG (reversed) Intergenic
No off target data available for this crispr