ID: 980774990

View in Genome Browser
Species Human (GRCh38)
Location 4:137425955-137425977
Sequence TCTGCTGGTGGGACAGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980774982_980774990 -4 Left 980774982 4:137425936-137425958 CCACCATCCTTATCGTACCTCTG No data
Right 980774990 4:137425955-137425977 TCTGCTGGTGGGACAGGTCCTGG No data
980774979_980774990 23 Left 980774979 4:137425909-137425931 CCACTGGGGTAATGAAAGGCCAT No data
Right 980774990 4:137425955-137425977 TCTGCTGGTGGGACAGGTCCTGG No data
980774981_980774990 -3 Left 980774981 4:137425935-137425957 CCCACCATCCTTATCGTACCTCT No data
Right 980774990 4:137425955-137425977 TCTGCTGGTGGGACAGGTCCTGG No data
980774980_980774990 4 Left 980774980 4:137425928-137425950 CCATGAGCCCACCATCCTTATCG No data
Right 980774990 4:137425955-137425977 TCTGCTGGTGGGACAGGTCCTGG No data
980774983_980774990 -7 Left 980774983 4:137425939-137425961 CCATCCTTATCGTACCTCTGCTG No data
Right 980774990 4:137425955-137425977 TCTGCTGGTGGGACAGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980774990 Original CRISPR TCTGCTGGTGGGACAGGTCC TGG Intergenic
No off target data available for this crispr