ID: 980780151

View in Genome Browser
Species Human (GRCh38)
Location 4:137483063-137483085
Sequence AAGGGCCTGTTAAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980780142_980780151 9 Left 980780142 4:137483031-137483053 CCCTCCAAGTGCATGGAGCATTA 0: 11
1: 17
2: 29
3: 36
4: 107
Right 980780151 4:137483063-137483085 AAGGGCCTGTTAAACTCTGGGGG No data
980780144_980780151 5 Left 980780144 4:137483035-137483057 CCAAGTGCATGGAGCATTATATA 0: 11
1: 8
2: 11
3: 17
4: 128
Right 980780151 4:137483063-137483085 AAGGGCCTGTTAAACTCTGGGGG No data
980780140_980780151 18 Left 980780140 4:137483022-137483044 CCTTTCTAACCCTCCAAGTGCAT 0: 7
1: 12
2: 30
3: 23
4: 150
Right 980780151 4:137483063-137483085 AAGGGCCTGTTAAACTCTGGGGG No data
980780143_980780151 8 Left 980780143 4:137483032-137483054 CCTCCAAGTGCATGGAGCATTAT 0: 11
1: 19
2: 26
3: 38
4: 114
Right 980780151 4:137483063-137483085 AAGGGCCTGTTAAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980780151 Original CRISPR AAGGGCCTGTTAAACTCTGG GGG Intergenic
No off target data available for this crispr