ID: 980784085

View in Genome Browser
Species Human (GRCh38)
Location 4:137530276-137530298
Sequence CTTTCATGTCACAAGAATAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
980784085_980784090 2 Left 980784085 4:137530276-137530298 CCCTTATTCTTGTGACATGAAAG 0: 1
1: 0
2: 0
3: 17
4: 226
Right 980784090 4:137530301-137530323 ACTTTCAGCCCCTTTGGGAATGG 0: 1
1: 0
2: 1
3: 23
4: 192
980784085_980784088 -3 Left 980784085 4:137530276-137530298 CCCTTATTCTTGTGACATGAAAG 0: 1
1: 0
2: 0
3: 17
4: 226
Right 980784088 4:137530296-137530318 AAGCCACTTTCAGCCCCTTTGGG 0: 1
1: 0
2: 2
3: 13
4: 151
980784085_980784087 -4 Left 980784085 4:137530276-137530298 CCCTTATTCTTGTGACATGAAAG 0: 1
1: 0
2: 0
3: 17
4: 226
Right 980784087 4:137530295-137530317 AAAGCCACTTTCAGCCCCTTTGG 0: 1
1: 0
2: 2
3: 16
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
980784085 Original CRISPR CTTTCATGTCACAAGAATAA GGG (reversed) Exonic
909495302 1:76271165-76271187 CTTTTATGTAATAAGCATAAAGG - Intronic
909544709 1:76833327-76833349 CCTACAAGTCACAAGAAGAAGGG - Intergenic
910586900 1:88890721-88890743 TTTTCAGGTCACAAGATTAAAGG + Intronic
912128874 1:106576247-106576269 CTATAATTTCACAAGAATAGTGG - Intergenic
912694621 1:111831941-111831963 CTTTCATATCTCCAGAACAATGG + Intronic
915202027 1:154237661-154237683 CTGACATGTCCCAAAAATAAAGG - Intronic
915807720 1:158872029-158872051 ATTTCACATCACAAGAATACAGG + Intergenic
921999220 1:221457668-221457690 CTTTCATGTCAAAGCAATGAGGG + Intergenic
924114089 1:240728638-240728660 CATGCATGCCCCAAGAATAAAGG + Intergenic
1063710363 10:8471378-8471400 CTGACCTGTCACAAGAATATAGG - Intergenic
1064041006 10:11963643-11963665 CTTACATGACACATGAATAATGG + Intronic
1069083686 10:64115162-64115184 CTTTGTTCTCACCAGAATAACGG - Intergenic
1069394413 10:67972962-67972984 CTTTCATCTCTTAAGAATACAGG - Intronic
1071775637 10:88784751-88784773 CTTTCATGTCACTACAAAATAGG - Intergenic
1072095097 10:92170512-92170534 CTGTCAGGTCACAAGTATGAGGG - Intronic
1072898995 10:99391045-99391067 CTTTGATGTCCCATGAATCAGGG - Intronic
1074910425 10:117903417-117903439 CTTTCATTTCACAAGATTTTAGG - Intergenic
1075318366 10:121469809-121469831 CTTTCAGATCAGAAAAATAAGGG + Intergenic
1075523307 10:123158648-123158670 CTGTGATGTGACAAAAATAATGG - Intronic
1076463674 10:130663920-130663942 CTTCCTTTTCACAAGAATGATGG - Intergenic
1078429661 11:11279168-11279190 CTTGCAGGTCACAAGATGAAGGG - Intronic
1079106943 11:17577871-17577893 CATTCATGTCACAGAAATAGTGG + Intronic
1080168417 11:29269130-29269152 TTTACAAGTCACAAGATTAAAGG + Intergenic
1080353148 11:31408679-31408701 CTTTCTTGATACAAAAATAAAGG - Intronic
1082149897 11:48725178-48725200 CATTCATCTCACAAAAATAAAGG + Intergenic
1083023886 11:59533680-59533702 CTTTCATGACACTACAATAGAGG - Intergenic
1085513962 11:77101795-77101817 CTTTCATTTCCCCAGTATAAAGG + Intronic
1086546006 11:87968238-87968260 ATTTCATGGCACAACAGTAAGGG + Intergenic
1089064137 11:115649644-115649666 CTTCCATTTCAGAAGAATAATGG + Intergenic
1089237842 11:117048181-117048203 CTTTCACATCACAAGCATACAGG + Intronic
1090519387 11:127462015-127462037 CCTTCAGGCCACAAGAATGAGGG + Intergenic
1091314390 11:134601742-134601764 CTATCAAGTCAATAGAATAAAGG + Intergenic
1091612183 12:2020478-2020500 CATGCATATAACAAGAATAAAGG + Intronic
1092794749 12:12099108-12099130 CTCTCCAGTCACAGGAATAATGG - Exonic
1094622612 12:32094529-32094551 CTTTCCTGTCTCTAGTATAATGG - Intergenic
1096932678 12:55231199-55231221 CCTTCATGAAATAAGAATAAAGG + Intergenic
1097608586 12:61787443-61787465 CTTTCATACCACTAGCATAAAGG + Intronic
1099545290 12:83971990-83972012 CTTGTATGTCACAATAATACAGG - Intergenic
1099715205 12:86284252-86284274 CATTCATCTCAGAAGACTAAAGG - Intronic
1099897330 12:88665264-88665286 CTTACATCTCCCAAGAATTAAGG + Intergenic
1100230449 12:92601339-92601361 CAATCATGTCAGAAGAAAAAGGG + Intergenic
1100233577 12:92634696-92634718 CTATCAAGCCACAAAAATAAAGG + Intergenic
1101225893 12:102687944-102687966 CTTTCATGTGGAAAGAAGAAGGG + Intergenic
1106458943 13:29951527-29951549 CTTTCATGGCAGAAGACAAAGGG + Intergenic
1107378694 13:39832455-39832477 CTTTCATATCAAAGGGATAAAGG + Intergenic
1108881604 13:55126597-55126619 CTTTTATGTCAAAAGAGTAATGG - Intergenic
1109158884 13:58947647-58947669 CATTCATGCTAGAAGAATAATGG - Intergenic
1109451932 13:62527116-62527138 TTTCCATGTGAAAAGAATAAAGG - Intergenic
1110620558 13:77589961-77589983 TTTTAATCTCACAATAATAATGG - Intronic
1111787614 13:92810151-92810173 CTTTGATTTCACAAGTATAGGGG - Intronic
1111835524 13:93383951-93383973 CATTCATTTCTTAAGAATAAAGG - Intronic
1113932942 13:113977947-113977969 CTTTCTTGTCACAAAAATACTGG - Exonic
1116213146 14:41973403-41973425 CTATCATGAGACAAGAAAAAGGG + Intergenic
1119118863 14:72053996-72054018 ATTTCACATCACAAGAATAGGGG + Intronic
1120374806 14:83690451-83690473 ATTCCATATCACTAGAATAAAGG - Intergenic
1120625827 14:86824993-86825015 TTTTCATGTTACAACAATTAGGG + Intergenic
1202904731 14_GL000194v1_random:61774-61796 CTTTCTTGGCAAAAGAAGAAAGG + Intergenic
1123488136 15:20759254-20759276 CTTTTAAGTCCCAGGAATAAAGG - Intergenic
1123544635 15:21328327-21328349 CTTTTAAGTCCCAGGAATAAAGG - Intergenic
1124112303 15:26802937-26802959 CATTCATGACACTAGGATAACGG - Intronic
1124960826 15:34392776-34392798 CTTTCTTTCCAAAAGAATAAAGG - Intronic
1124977455 15:34538997-34539019 CTTTCTTTCCAAAAGAATAACGG - Intronic
1129550587 15:76444727-76444749 CATTCATGTCACCAGACTCATGG - Intronic
1130824095 15:87525797-87525819 ATTTCATGTGACAAGATTTATGG + Intergenic
1131746217 15:95451239-95451261 CTATCATCTCACGTGAATAAAGG - Intergenic
1202952979 15_KI270727v1_random:55598-55620 CTTTTAAGTCCCAGGAATAAAGG - Intergenic
1134701711 16:16271353-16271375 CTTTCATTTCTCAAGAAAATTGG - Intronic
1134970119 16:18523297-18523319 CTTTCATTTCTCAAGAAAATTGG + Intronic
1137923133 16:52511803-52511825 CTTTCAAGTCATTAGAATATAGG - Intronic
1138151145 16:54658398-54658420 CTTTAATGTCACCAGTTTAACGG - Intergenic
1140200476 16:72890664-72890686 CTTTCCTGGCACAAGGTTAAAGG + Intronic
1140286662 16:73609374-73609396 CTTCCATTTCAAAAAAATAAAGG + Intergenic
1140604462 16:76518078-76518100 CTTTTATCTTACCAGAATAAAGG - Intronic
1140620443 16:76723566-76723588 CCTTGCTGGCACAAGAATAAAGG - Intergenic
1140962756 16:79932283-79932305 TCTTCATGTCACAAATATAAAGG + Intergenic
1144425798 17:15140979-15141001 CTTTCATGTCAACCTAATAATGG - Intergenic
1146850894 17:36220781-36220803 CTTTCAGGTCACTAGATAAATGG - Intronic
1149490614 17:57082533-57082555 CTTTGATGTCACAAAAACAATGG + Intergenic
1153432658 18:5035786-5035808 CTTTCATTTCTGAAAAATAAAGG + Intergenic
1159459255 18:68702806-68702828 AATTCAATTCACAAGAATAAGGG + Intronic
1159537180 18:69728916-69728938 CCTTGATGTCACAAAAATCATGG - Intronic
1160283726 18:77518677-77518699 CTTTGATTTCACAATAATAAAGG - Intergenic
1165539679 19:36481982-36482004 CTTTAATGTAAAAAGAATATAGG + Intronic
1165898608 19:39157603-39157625 CGTTCATGTCTCTAGAATATGGG - Intronic
1166639483 19:44483118-44483140 CTTTCAAGGAACAAGAGTAAAGG - Intronic
1167777380 19:51567948-51567970 CATTCTAGACACAAGAATAAAGG + Intergenic
1168085257 19:54041242-54041264 CATTGATGTCACAGGCATAAAGG - Intronic
925024829 2:599467-599489 CTTTTAAGTCCCAGGAATAAAGG + Intergenic
925121443 2:1421715-1421737 CTTTCAGCTCTCAAGAATCAGGG - Intronic
925385464 2:3458933-3458955 ATTTCTTTTCACAAAAATAATGG + Intronic
925638863 2:5968249-5968271 CTTTCATGAAACAAGATAAATGG + Intergenic
926253714 2:11171513-11171535 TTTTCAGGTCAAAATAATAATGG - Intronic
928847481 2:35694862-35694884 ACATCATGTCAAAAGAATAAAGG - Intergenic
931682679 2:64765218-64765240 CTAACATGCCACAAGAATAGAGG + Intergenic
931765312 2:65450875-65450897 CTTTAATCTCACTAGAACAAGGG + Intergenic
931982117 2:67704986-67705008 CTTTCATGTCTCAGTAATTATGG - Intergenic
933171665 2:79132246-79132268 CTTTTATCTCACAAGAAAGATGG + Intergenic
933265724 2:80178645-80178667 CTTTCAGGTCACTCGAAAAATGG + Intronic
933298106 2:80513626-80513648 CTATCATGTGACAAGAAAGATGG - Intronic
935936736 2:108193544-108193566 CTTTGATGTCAGGAGAAGAAGGG + Intergenic
937996489 2:127698389-127698411 CTTTCCACTCACAAGCATAATGG - Intergenic
938899095 2:135783662-135783684 TTTGCATCTCACAAGAACAAAGG - Exonic
938962181 2:136353769-136353791 CTTACATGTCAGAAGAAGGACGG - Intergenic
939468918 2:142594341-142594363 CCTTCATGTAACAAGAGTACTGG - Intergenic
941657551 2:168160100-168160122 CATTAATCTGACAAGAATAATGG + Intronic
941792909 2:169572617-169572639 CTTTAAGGGCACAAGAAAAAGGG - Intronic
942712066 2:178847876-178847898 CTTTCATGGTAAAAGAATGAGGG - Intronic
943108652 2:183579114-183579136 ATGTCATGTGACAAGAATAATGG - Intergenic
944177171 2:196844243-196844265 CTAGCAAGTCAAAAGAATAAAGG - Intronic
944403636 2:199357437-199357459 CTATCATGTGCCAGGAATAATGG + Intronic
944705842 2:202287420-202287442 CATTCATGTTACAGAAATAAAGG + Intronic
946525699 2:220517147-220517169 CTTTCTTCTCACAAGCAAAAGGG - Intergenic
946566231 2:220968839-220968861 CATACATGTCACAAAGATAATGG + Intergenic
947018301 2:225646003-225646025 CTTTGATGTCACAGGCCTAAAGG + Intronic
947078545 2:226370084-226370106 GTTTCATGTGGCAAGAATGAAGG + Intergenic
947115590 2:226767095-226767117 TTTGCATGTCACCAGAAAAAAGG + Intronic
949045057 2:241868799-241868821 CTGTCATGGCACAACAAGAAAGG - Intergenic
1169858336 20:10127027-10127049 TTTTTTTGTCACAAGAAGAATGG + Intergenic
1171107405 20:22447954-22447976 CCTTCTTGTCACAATAATGAAGG + Intergenic
1172953819 20:38740686-38740708 CTTTCAAGTCTAAAGAAAAATGG - Intergenic
1173097802 20:40053648-40053670 CTTTAATGCCACATTAATAATGG + Intergenic
1173409546 20:42797641-42797663 CTTTCATGGCAAGAGAATTAAGG + Intronic
1176450198 21:6855339-6855361 CTTTTAAGTCCCAGGAATAAAGG + Intergenic
1176624101 21:9076541-9076563 CTTTCTTGGCAAAAGAAGAAAGG + Intergenic
1176828367 21:13720357-13720379 CTTTTAAGTCCCAGGAATAAAGG + Intergenic
1177255296 21:18653726-18653748 GTTTCATGATACAAGAATATGGG + Intergenic
1177969572 21:27772146-27772168 GTTTCATGTAACAATAAGAATGG + Intergenic
1178013942 21:28320229-28320251 TTTTCATGGCAGAAGAAGAAAGG - Intergenic
1178206331 21:30470852-30470874 TTTTCATGTTAAAATAATAAGGG - Intergenic
1183111089 22:35649011-35649033 GTGTCATCTCACAAGAAAAAAGG + Intronic
1184263620 22:43334002-43334024 CTTTGCTGTGATAAGAATAAAGG - Intronic
1184471686 22:44699542-44699564 CATTTATCTCATAAGAATAAAGG - Intronic
951120914 3:18927598-18927620 CTTCCAAGTCACAAGAAGAGGGG - Intergenic
951624043 3:24640529-24640551 TTTTTAGGTCACAGGAATAAGGG - Intergenic
952542588 3:34382147-34382169 CTTTTCTGTAACAAGAAGAAAGG - Intergenic
955157928 3:56435545-56435567 CTTTCAAGTCACATGCATATAGG - Intronic
955674961 3:61438502-61438524 CTTTCCTGTCTAAAGAACAAAGG + Intergenic
957617031 3:82543032-82543054 ATTTGATGTCACAATAATTAGGG + Intergenic
959678465 3:109065146-109065168 ATTTCATGGGACAAGAAGAAAGG - Intronic
961092553 3:124126950-124126972 CTTTCATTTCACTTGGATAATGG - Intronic
962623383 3:137200752-137200774 TTTTAAAGTCACAAGAATAAGGG - Intergenic
967681443 3:192368748-192368770 CTTTCATGCTACAACAACAAAGG + Intronic
970330157 4:14974433-14974455 CATTCATGTCACTGGAATATGGG + Intergenic
972035661 4:34515938-34515960 CTATCTTTTCACAAGAATGAAGG + Intergenic
972262478 4:37423829-37423851 TTCTCATGTCACAAGTAGAAAGG - Intronic
972887853 4:43514726-43514748 CTTCCAAGTCACATGAAAAATGG - Intergenic
972960870 4:44449560-44449582 CTTTCAGTTCACAATAATAAAGG + Intergenic
972998188 4:44909896-44909918 ATTTCATGGGACTAGAATAAAGG + Intergenic
974706508 4:65523890-65523912 CTTTCATATCACAAGAGTGAAGG + Intronic
978140964 4:105317022-105317044 CTTCCATGTCACTAGAAGATTGG - Intergenic
979794166 4:124824814-124824836 CTTTCATGTCTCCAGATTAATGG - Intergenic
980251828 4:130325669-130325691 CTGTGATGTCACTAGAATATGGG + Intergenic
980614895 4:135206722-135206744 CTTTCCTTTCAAAAGAGTAAAGG + Intergenic
980784085 4:137530276-137530298 CTTTCATGTCACAAGAATAAGGG - Exonic
981314394 4:143327661-143327683 TTTTCATGTCACAATTACAAAGG + Intergenic
984794283 4:183643957-183643979 CTTTCATCTCCCAAGATTACTGG + Intronic
985380268 4:189387111-189387133 CTTTCATCTCTCAATTATAATGG + Intergenic
985984423 5:3502891-3502913 TTTTCCTGTCTCAAGAAGAATGG - Intergenic
986086202 5:4452580-4452602 CTTTCATACCACAATAACAAAGG + Intergenic
986479537 5:8172413-8172435 CTTTCAAGCCACAGTAATAAAGG + Intergenic
986483922 5:8216836-8216858 CTTCCATATCAAAAGTATAAAGG - Intergenic
987483172 5:18485321-18485343 CTTTCATTTCATATGAAGAATGG - Intergenic
988061771 5:26179458-26179480 CTTTTATATAACAGGAATAATGG - Intergenic
989210101 5:38850413-38850435 CTTTCTTTTAACAAAAATAAAGG - Intronic
990123283 5:52482926-52482948 CTTTCACTTCACAAAGATAAAGG + Intergenic
990859177 5:60307501-60307523 TTCTCAGGTCACAAGAAGAAAGG + Intronic
993531599 5:89031776-89031798 CTTTCAAGTCAAAAGAATCAAGG + Intergenic
993550621 5:89269483-89269505 CTCTCTTGCCACAAGAATCATGG + Intergenic
993606470 5:89996333-89996355 TTCTCAAGTTACAAGAATAATGG - Intergenic
994143767 5:96370089-96370111 GTTTCATATCACAAGGAAAATGG - Intergenic
997012199 5:129892018-129892040 CTTTGAAGTCACAATAATAGTGG - Intergenic
997148930 5:131470566-131470588 CTTTCATGAGACAAGTATTAGGG - Intronic
999663515 5:153889990-153890012 TTTTCATGCCTCTAGAATAAAGG - Intergenic
1000057132 5:157617037-157617059 CCTTCATGTCACTGGAATGATGG + Intergenic
1000529169 5:162397508-162397530 CTTTCCTGTAACAATAATATTGG - Intergenic
1001992128 5:176126243-176126265 CATTACTGTTACAAGAATAATGG - Intronic
1002224746 5:177711922-177711944 CATTACTGTTACAAGAATAACGG + Intronic
1008418392 6:51269548-51269570 CTTTCAGATCATAAGAAAAAAGG + Intergenic
1008445082 6:51579651-51579673 CTTTTTTGTCATAAGAAGAATGG - Intergenic
1010941128 6:81918832-81918854 CTACCATGTGACAAGAAGAAGGG - Intergenic
1012758381 6:103263424-103263446 CTTTCATCTCATAAAAAGAATGG - Intergenic
1013050904 6:106534035-106534057 CTTTCATGTAAAAAAATTAAAGG - Intronic
1014919282 6:127193843-127193865 CTTTTAAGTGAAAAGAATAATGG + Intronic
1017357089 6:153521963-153521985 CTTTTTTCTCTCAAGAATAAAGG + Intergenic
1020019901 7:4858833-4858855 GTGTCATTTCACAAGAAAAAAGG - Exonic
1020477075 7:8608761-8608783 CATTCATATCACACGAAAAATGG - Intronic
1020692634 7:11375486-11375508 CTTTCATCTCTAAAAAATAATGG - Exonic
1020791134 7:12629686-12629708 CATTAAATTCACAAGAATAATGG + Intronic
1023422265 7:39993398-39993420 AGGTCATGTCAAAAGAATAAAGG - Intronic
1023704475 7:42926974-42926996 ATTTCATGTTATAAGAATATTGG - Intronic
1023738364 7:43254869-43254891 CTTTTATGTCACTAGAAGAAGGG + Intronic
1024081049 7:45855349-45855371 ATTTCATGTCCAAAGAAAAAAGG - Intergenic
1024096301 7:45985452-45985474 CTTCAATGTCCCAAGAAAAAAGG - Intergenic
1024973333 7:55090583-55090605 CTTTCAGGTCATAAGATTTATGG - Intronic
1026389877 7:69889655-69889677 ATTACATGTAAAAAGAATAATGG + Intronic
1026400326 7:70005304-70005326 CTTTTGTGTCACAAAAGTAAAGG + Intronic
1028728531 7:94117518-94117540 CTTTCAAGTTACATGAAAAAGGG + Intergenic
1029821036 7:103147819-103147841 CTTTCCTGCTACAAGAATTATGG - Intronic
1030041199 7:105451796-105451818 GTTGCATGTCACCAGTATAATGG - Intronic
1030983557 7:116213468-116213490 ATTTCATGTAAAAAGAATTAAGG + Intronic
1031104359 7:117522718-117522740 CTTTCTTGTACCAAGAATATAGG + Intronic
1033064034 7:138135762-138135784 CTTTCATGTCAGGATAATATTGG + Intergenic
1036141532 8:6213422-6213444 CCTTAATGTCACAGGAATGAAGG - Intergenic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1038408288 8:27339226-27339248 TTATCATGTCACAAGCCTAAAGG - Intronic
1038894116 8:31761702-31761724 CTTTCATGTTACTACCATAATGG - Intronic
1039381107 8:37086219-37086241 CTTTCATGCCACCATCATAATGG + Intergenic
1041586598 8:59527890-59527912 ATTTCAGGTCCCAAGAATAAAGG + Intergenic
1041816956 8:61984383-61984405 CTTACATGCCACAAGACTATGGG + Intergenic
1042916461 8:73879921-73879943 CTTTTATGTTACCAGAATGAAGG + Intergenic
1043166051 8:76903823-76903845 ATTTCATGTTATAAAAATAATGG - Intergenic
1043447700 8:80335264-80335286 CTTTAATGACAGAAGAAAAATGG - Intergenic
1044654321 8:94531722-94531744 TTTTCATGCCAAAAAAATAAGGG + Intronic
1045090054 8:98732571-98732593 TCTTCATGATACAAGAATAAGGG - Intronic
1046583750 8:116125524-116125546 CTTTCACCTGAGAAGAATAAAGG + Intergenic
1047110724 8:121786495-121786517 CTTTCATGTCACTTGCTTAAAGG - Intergenic
1048075802 8:131069587-131069609 GTGTCATCTCACATGAATAATGG - Intergenic
1048816527 8:138339738-138339760 CTTTCCTGTAACAAGAAGCAAGG - Intronic
1050265672 9:3887057-3887079 TTTTCATGCCACAAGGAGAAGGG - Intronic
1050735866 9:8762574-8762596 CTATCATGTCACCAGATGAACGG + Intronic
1051139116 9:13958952-13958974 CTTTTTTGTCACCAGAAAAATGG + Intergenic
1051153894 9:14118453-14118475 CTCTCATTTGAAAAGAATAAAGG + Intronic
1051158677 9:14180985-14181007 CTTTCTTGGCTCAAGTATAATGG - Intronic
1053523221 9:38803128-38803150 CCTTCAAGTCACCAGAATCATGG - Intergenic
1054195449 9:62027547-62027569 CCTTCAAGTCACCAGAATCATGG - Intergenic
1054642958 9:67561142-67561164 CCTTCAAGTCACCAGAATCATGG + Intergenic
1054743910 9:68835089-68835111 CTTTCATGTTACAAAGAAAAGGG - Intronic
1058637371 9:107049592-107049614 CTTTAATGTCAAAGGAACAATGG + Intergenic
1058878865 9:109269212-109269234 TTTTCCTGGCAAAAGAATAAAGG - Intronic
1060370501 9:123065464-123065486 ATTTCATGTCAAAAAAAAAAAGG + Intronic
1203518984 Un_GL000213v1:29178-29200 CTTTTAAGTCCCAGGAATAAAGG - Intergenic
1203747282 Un_GL000218v1:46969-46991 CTTTCTTGGCAAAAGAAGAAAGG + Intergenic
1203562819 Un_KI270744v1:72511-72533 CTTTCTTGGCAAAAGAAGAAAGG - Intergenic
1187123995 X:16436373-16436395 TTTTCATGTCACAGTAATCAAGG - Intergenic
1187138924 X:16574982-16575004 TTTTCCTGTCACAAGATTAATGG - Intergenic
1188821436 X:34780011-34780033 CTTTCTTCTCACTAGAATATAGG + Intergenic
1190565889 X:51730039-51730061 CTTTCCTGTCAAAACCATAAAGG + Intergenic
1193372842 X:80718519-80718541 GTTTTATGTCTCAGGAATAAAGG + Intronic
1194126056 X:90018403-90018425 CTTTCAATTCACTAGGATAAAGG - Intergenic
1196636303 X:118006928-118006950 CCTTCATATCACATGAGTAAAGG + Intronic
1199138236 X:144278668-144278690 CTTTTATGTCTCAAAAAAAATGG - Intergenic
1199535872 X:148902578-148902600 CTCCCATGTCAGAAGAACAAAGG - Intronic
1201160603 Y:11161962-11161984 CTTTCTTGGCAAAAGAAGAAAGG + Intergenic
1201953418 Y:19591663-19591685 CTTTCCTGTCACTAGAAAAGAGG + Intergenic